Anonimo
Anonimo ha chiesto in Matematica e scienzeBiologia · 10 mesi fa

Sono nuova qui su questa piattaforma millenaria, ma vabbè. Mi serve un aiutino per biologia (robe di dna, cose simpaticissime).?

C'è questo gene (GCTTACGATCACGGTAATGCTCAGGCATCTCCCAATGTTACAGAAATTCGGATCACT) 

La decima base azotata subisce una delezione; come si traduce in mRNA e poi in aminoacidi? Qualche gentiluomo che me lo trasforma?  

2 risposte

Classificazione
  • Acq
    Lv 7
    10 mesi fa

    GCTTACGAT C ACGGTAATGCTCAGGCATCTCCCAATGTTACAGAAATTCGGATCACT

    La C staccata è la decima base azotata

    Su RNA ad ogni G si collega una C, ad ogni C una G, ad ogni A una U ed ad ogni T una A

    La traduzione in amminoacidi è sul libro.

  • Mars79
    Lv 7
    10 mesi fa

    Si scrive DNA......................................

Altre domande? Fai una domanda e ottieni le risposte che cerchi.