promotion image of download ymail app
Promoted
Anonimo
Anonimo ha chiesto in Matematica e scienzeBiologia · 2 mesi fa

Cosa simpaticissima di biologia sul DNA. Chi mi da 5 minuti del suo tempo :)  ?

C'è questo gene (GCTTACGATCACGGTAATGCTCAGGCATCTCCCAATGTTACAGAAATTCGGATCACT) 

La decima base azotata subisce una delezione; come si traduce il gene in mRNA e poi in aminoacidi? 

1 risposta

Classificazione
  • Anonimo
    2 mesi fa

    Io lo farei così: per prima cosa elimini come ti viene detto la base n° 10, ovvero la C. Poi unendo a 3 a 3 le basi che hai ti trovi il lungo elenco di aminoacidi codificati (vedi link per il riferimento, devi scorrere fino a sezione "Tabella codifica codoni nel DNA"), es GCT= alanina e poi converti tutta la stringa di lettere in linguaggio RNA, ovvero tutte le T diventano U

    ------

    https://it.wikipedia.org/wiki/Codice_genetico

    • Commenter avatarAccedi per rispondere alle risposte
Altre domande? Fai una domanda e ottieni le risposte che cerchi.